IntechOpen

Home > Books > Advances and Perspectives of Infections Caused by <em>Staphylococcus aureus</em> [Working Title]

Open access peer-reviewed chapter - ONLINE FIRST

Detection and Typing of Staphylococcus aureus Strains in Pediatric Population of Mexico City

Written By

Anaid Bustos-Hamdan, Samuel González García, Juan Antonio Guzmán Salgado, Aída Hamdan-Partida and Jaime Bustos-Martínez

Submitted: 06 August 2024 Reviewed: 29 October 2024 Published: 23 December 2024

DOI: 10.5772/intechopen.1008470

Advances and Perspectives of Infections Caused by <em>Staphylococcus aureus</em> IntechOpen
Advances and Perspectives of Infections Caused by Staphylococ... Edited by Jaime Bustos-Martínez

From the Edited Volume

Advances and Perspectives of Infections Caused by Staphylococcus aureus [Working Title]

Jaime Bustos-Martínez, Juan José Valdez-Alarcón and Aída Hamdan-Partida

Chapter metrics overview

8 Chapter Downloads

View Full Metrics
Advertisement

Abstract

Staphylococcus aureus is one of the main bacteria that infect humans. The pediatric population is susceptible to this microorganism; in Mexico there are not enough epidemiological studies on this subject, so the objective of this work was to detect and typify S. aureus strains in an apparently healthy pediatric population of daycare centers and schools. Nasal and pharyngeal exudates were collected to determine the presence of these bacteria and typed as HA-MRSA or CA-MRSA strains by determining SCCmec, mecA gene, Panton-Valentine leucocidin (PVL), phenol-soluble modulin (psm), and spa-type. It was found that 62.55% of the population were carriers of S. aureus, with a higher percentage in the pharynx and in children older than 4 years of age. A total of 7.04% were carriers of MRSA strains, of which 14.64% were HA-MRSA strains and 85.36% were CA-MRSA strains. The strains showed resistance to several antibiotics. About 20% of the MRSA strains had PVL and psm genes. The strains presented a great variety of spa-types. A high number of S. aureus carriers were found in the pediatric population studied, with the presence of CA-MRSA strains, so surveillance and decolonization programs should be established.

Keywords

  • Staphylococcus aureus
  • pediatric population
  • CA-MRSA
  • HA-MRSA
  • spa-type
  • antibiotic resistance

1. Introduction

Staphylococcus aureus is a bacterium with the shape of cocci grouped in clusters, Gram positive, facultative anaerobic, nonmotile, ferments mannitol and is halophilic, and is positive to the catalase, oxidase and coagulase tests. It is a commensal bacterium that can become pathogenic because it possesses virulence factors that allow it to survive innate immune mechanisms when entering humans, among which are adhesins that allow it to anchor to host cells to begin colonization, exoenzymes that degrade molecular components of tissues, superantigens and toxins, it can also synthesize polysaccharides associated with surfaces and capsule to protect itself, among many other factors that allow it to persist and resist multiple antibiotics [1, 2].

The most pathogenic S. aureus strains are those with methicillin resistance, methicillin-resistant Staphylococcus aureus (MRSA), which is included in the ESKAPE group (Enterococcus faecium, S. aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa y Enterobacter spp), of multidrug-resistant bacteria [1], this bacterium has generated a high mortality rate worldwide and one of the most affected populations is the pediatric population [3]. Another important strain is methicillin-sensitive Staphylococcus aureus (MSSA), which has gained more ground at the hospital level [4]. MRSA strains can be divided into three main types, corresponding to community-acquired methicillin-resistant S. aureus (CA-MRSA), hospital-acquired (HA-MRSA) and livestock-associated (LA-MRSA) [1]. In reports from the 1960s, strains isolated at the hospital level (HA-MRSA) were observed for the first time, and in the 1990s the first cases of infections at the community level (CA-MRSA) were reported [5, 6].

Previously it was believed that infections produced by MRSA strains in the hospital were the most serious, however, nowadays community infections are also behaving in a serious way including in the pediatric population. This problem has to do in part with the indiscriminate use of antibiotics, which has generated a condition of multi-resistance to antibiotics in strains of S. aureus, placing it on the WHO list as a priority pathogen resistant to antibiotics [5, 6, 7].

The risk of infection by S. aureus, especially MRSA strains, increases among different susceptible populations such as children, the elderly, athletes, overcrowded living conditions, the military, people who use injectable drugs, immunodeficient people, and even people who frequent hospital centers [5, 6]. This risk of infection usually occurs due to increased exposure to the bacteria and decreased defense mechanisms in different at-risk populations [5, 7].

Colonization by this bacterium is a risk factor for triggering invasive infections in hospitals and communities [5, 6, 7]. Colonization tends to be mainly at the nasal and pharyngeal level where it predisposes to suffer from infections ranging from mild to complicated [8]. As has been reported in previous studies, there is a colonization by S. aureus with a different percentage according to the colonized site. S. aureus colonization at the level of the nose has been reported in 20–40% of the general population [5], while in the pharynx colonization ranges from 4 to 64% [8].

Currently, it is known that there are multiple factors to trigger colonization, for example, the airway, food, skin-to-skin contact, age, especially children and older adults, immunocompromised persons, livestock farmers. Up to 30% of people are colonized by S. aureus permanently and 30% are usually colonized intermittently, and 2–10% are colonized with MRSA strains [7, 9].

As it has been reported worldwide about one-third of the population is colonized by S. aureus, this allows it to be an important factor producing infections in the different stages of life [7]. S. aureus is an agent with a high prevalence rate either at the hospital level, mainly with MRSA strains, or at the community level with MSSA and MRSA strains [7, 9].

Infections caused by S. aureus have increased in recent years, including in the pediatric population [7, 9, 10]. Studies show that S. aureus is the main cause of pediatric infections and soft tissue infections in children, and it is also the second cause of death due to neonatal sepsis [10, 11].

Pediatric S. aureus infections can range from mild to life-threatening infections such as necrotizing fasciitis, bacteremia, osteomyelitis and endocarditis, resulting in a high mortality of up to 22–66% [7, 10].

There are risk factors related to pediatric colonization and infection, among the main pediatric factors that have been related are age, children 12 months old, prematurity, low birth weight (<1500 g), asthma and eczema [4, 12].

However, the epidemiology of pediatric S. aureus infections is highly variable worldwide, which varies depending on the countries studied; a percentage of up to 48% has been reported in the United States [3]. In the case of MSSA strains, it has been described that they can cause an incidence of infections up to 2.2% higher than infections caused by MRSA strains [4, 7, 11]. Currently, there has been an increase in the number of cases in the pediatric population at the level of community infections with CA-MRSA strains, but HA-MRSA strains should not be overlooked [3]. Therefore, it is essential to have knowledge of the epidemiology of S. aureus, the type of strains, their characteristics and virulence factors that may be involved in the infection and their resistance to antibiotics, this information is crucial in the diagnosis and timely treatment at the pediatric level, in order to avoid further morbidity and mortality [3].

In Mexico, there are not enough epidemiological studies on the prevalence of S. aureus in the pediatric population, so the objective of this study was to determine and typify the presence of this bacterium in the pediatric population of Mexico City.

Advertisement

2. Methods

2.1 Sampling

Pharyngeal and nasal swabs were collected from 582 apparently healthy children and adolescents aged 6 months to 18 years from daycare centers and schools in Mexico City between 2013 and 2019. Informed consent was requested for sample collection and parental consent was requested for minors. Nasal sampling was performed by inserting a sterile swab into both nostrils, and pharyngeal sampling was performed with another swab by gently scraping the oropharynx. Both swabs were stored and transported in separate tubes with trypticase soy broth (TSB) at room temperature until reaching the laboratory, where they were incubated at 37°C for 24 h, after which time they were inoculated in salt and mannitol agar dishes by the cross-stretch method and incubated for 24 h at 37°C.

2.2 Identification of Staphylococcus aureus

All strains that grew on mannitol salt agar as circular yellow colonies measuring 2–3 mm in diameter and that turned the color of the agar yellow, and that the coagulase test was positive, were considered as S. aureus, if any strain presented inconclusive results, DNA was extracted using the DNA Wizard Genomic Extraction Kit, to perform a PCR of the 16S rRNA gene [13] and subsequent sequencing at Macrogen Korea, the sequences were identified using nBLAST.

2.3 Antibiogram

The antibiogram test was performed on all S. aureus strains using the Kirby-Bauer method according to CLSI guidelines [14], strains were grown in TSB at 37°C overnight, in a tube with sterile Mueller-Hinton broth the bacterial suspension was adjusted to a concentration of 0.5 McFarland units using a Densimat (bioMériux, France), then a sterile swab was dipped in the bacterial suspension to massively seed a Mueller-Hinton agar plate, Gram-positive polydisks (PBM, Mexico) were used, for the antibiotics: ciprofloxacin (CIP), fosfomycin (FO), trimethoprim-sulfamethoxazole (TSX), penicillin (P), vancomycin (VA), tetracycline (TE), Erythromycin (E), oxacillin (OX), macrolides (MAC), clindamycin (CC), gentamicin (GM) and cephalothin (CF).

2.4 Identification of MRSA strains

The minimum inhibitory concentration (MIC) test for oxacillin was performed according to CLSI guidelines [14], MRSA strains were considered to be those that grew at concentrations of ≥4 μg/mL, using S. aureus strains ATCC 43300 and ATCC 29213 as positive and negative controls, respectively. The presence of the mecA gene was also determined by PCR following the methodology previously described [15, 16].

For the typing of MRSA strains, the identification of the staphylococcal cassette chromosome (SCCmec) was performed by multiplex PCR [15] using the primers CIF2 F2, CIF2 R2, MECI P2, MECI P3, RIF5 F10 and FIF5 R13, at a final concentration of 400 nM, in addition to the primers DCS F2, DCS R2, MECA P4 and MECA P7 at a final concentration of 800 nM, and the primers KDP F1, KDP R1, RIF4 F3 and RIF4 R9 at a final concentration of 200 nM (Table 1). The thermocycling conditions were: initial denaturation for 4 minutes at 94°C; followed by 30 cycles of 94°C for 30 seconds, 53°C for 30 seconds and 72°C for 1 minute, plus a final extension of 4 minutes at 72°C, ending by maintaining the temperature at 4°C. In addition, another multiplex PCR was performed with the conditions reported by Boye et al. in 2007 [16], using the primers β, α-3 (0.2 μM), ccrCF, ccrCR (0.25 μM), 1272F1, 1272R1 (0.08 μM) and 5RmecA and 5R431 (0.1 μM) (Table 1), with the following thermocycling conditions: initial denaturation at 94°C for 4 minutes, followed by 30 cycles of 30 seconds at 94°C, 30 seconds at 55°C and 1 minute at 72°C, with a final extension at 72°C for 4 minutes. S. aureus strains BAA-44, BAA-41, BAA-39, NRS 643 and NRS 745 were used as positive controls for SCCmec cassettes I, II, III, IV and V, respectively.

GenesPrimersSequence (5′-3′)Amplicon (bp)Reference
SCCmecCICF F2
CIF2 R2		TTCGAGTTGCTGATGAAGAAGG
ATTTACCACAAGGACTACCAGC		495[15]
KDP F1
KDP R1		AATCATCTGCCATTGGTGATGC
CGAATGAAGTGAAAGAAAGTGG		284
MECI P2
MECI P3		ATCAAGACTTGCATTCAGGC
GCGGTTTCAATTCACTTGTC		209
DCS F2
DCS R1		CATCCTATGATAGCTTGGTC
CTAAATCATAGCCATGACCG		342
RIF4 F3
RIF4 R9		GTGATTGTTCGAGATATGTGG
CGCTTTATCTGTATCTATCGC		243
mecAMECA P4
MECA P7		TCCAGATTACAACTTCACCAGG
CCACTTCATATCTTGTAACG		162[15]
SCCmecβ
α-3		ATTGCCTTGATAATAGCCYTCT
TAAAGGCATCAATGCACAAACACT		937[16]
ccrCF
ccrCR		CGTCTATTACAAGATGTTAAGGATAAT
CCTTTATAGACTGGATTATTCAAAATAT		518
1272F1
1272R1		GCCACTCATAACATATGGAA
CATCCGAGTGAAACCCAAA		415
5RmecA
5R431		TATACCAAACCCGACAACTAC
CGGCTACAGTGATAACATCC		359
PVLluk-PV-F
luk-PV-R		GCATCAASTGTATTGGATAGCAAAAGC
ATCATTAGGTAAAATGTCTGGACATGATCCA		433[17]
psmPSMaTCCTTCCTTTCGATGTCGTT
CCATCTTTTACGATGGTGGTTT		221[18]
spaspa-1113 F
spa-1514 R		TAAAGACGATCCTTCGGTGAGC
CAGCAGTAGTGCCGTTTGCTT		443[19]

Table 1.

Primers used in the identification and typing of S. aureus strains.

bp: base pairs.

The presence of lukS-PV/lukF-PV genes of Panton-Valentine leukocidin (PVL) was amplified by end-point PCR using the primers reported by Lina et al. [17] (Table 1), with a thermocycling of 5 minutes of initial denaturation at 94°C, followed by 30 cycles of 30 seconds at 94°C, 55°C 30 seconds, and one minute of extension at 72°C, using as a positive control the strain of S. aureus BAA-1680, the gene of the phenol soluble modulin (psm) was also amplified by end-point PCR following the methodology and primers published by Mehlin et al. [18] (Table 1), with the thermocycling conditions of: 4 minutes at 94°C of initial denaturation, followed by 35 cycles of 15 s at 94°C, 15 s at 55°C and 90 s at 72°C, with a final extension at 72°C for 9.5 minutes.

Typing of S. aureus (spa-typing) was obtained by amplifying the spa gene through PCR with the following thermocycling conditions: initial denaturation at 80°C for 5 minutes, followed by 35 cycles of 94°C 45 s, 60°C 45 s, 72°C 90 s, plus 10 minutes of final extension at 72°C, using the primers published by Shopsin et al. [19] (Table 1), and the S. aureus strain ATCC 43300 as a positive control, and subsequently sequencing the amplicons in MacroGen (Korea). The spa-types were assigned using the SPA Searcher (http://seqtools.com) and Ridom GmbH (http://spaserver.ridom.de/) website. Community-acquired strains (CA-MRSA) strains were considered as CA-MRSA strains if they had SCCmec IV, IVa or V and could have the PVL gene, and hospital-acquired strains (HA-MRSA) were typed as HA-MRSA strains if they had SCCmec I, II or III [20].

All PCR reactions were performed using the commercial PCR Master Mix 2X kit (Promega, USA) in the MyClycer thermal cycler (BioRad, USA). PCR products were identified by performing 1% agarose gel electrophoresis (BioRad) in 0.5X Tris Borate EDTA buffer (TBE, BioRad), the agar gel was placed in an ethidium bromide solution (0.5 μg/mL) and developed in a UV light transilluminator (SYNGENE).

2.5 Statistical analysis

The chi-square test and Fischer’s F test were performed considering values with a statistical difference of p < 0.05 with SPSS software version 25.0. (IBM, NY, USA).

Advertisement

3. Results

3.1 S. aureus carriers

We analyzed 317 women (54.46%) and 265 men (45.54%), with a mean age of 9.38 years (±5.13), finding that 62.55% (364) are S. aureus carriers, of which 159 (27.31%) are carriers in both sites, 125 (21.47%) are exclusive pharynx carriers and 80 (13.74%) are exclusive carriers in the nose. Thus, pharynx carriers are more than nose carriers. In addition, 218 (37.45%) were found not to be S. aureus carriers (Table 2). Women presented a slightly higher percentage of carriers than men (35.33% vs. 27.31%), the greatest significant difference being found in exclusive nose carriers where in women it was 10.8% vs. 2.92% in men (Table 2). In addition, a total of 523 S. aureus strains were isolated, of which 284 were found in the pharynx (54.30%) and 239 in the nose (45.70%).

Carriers and non-carriers of S. aureus
Non-carriersCarriersBoth sitesPharynxNose
N = 582218 (37.45%)364 (62.55%)*159 (27.31%)125 (21.47%)80 (13.74%)
Women (n = 317) 54.46%112 (19.14%)205 (35.22%)83 (14.26%)59 (10.13%)63 (10.80%)**
Men (n = 265) 45.54%106 (18.20%)159 (27.31%)76 (13.05%)66 (11.34%)17 (2.92%)

Table 2.

Carriers of S. aureus in the pediatric population analyzed.

When comparing non-carrier vs. carrier: * p < 0.05; when comparing isolated female vs. male nasal carriers: ** p < 0.01.

Carriers were analyzed by age group. Group 1: 141 individuals aged 1–3 years; Group 2: 143 individuals aged 4–6 years; Group 3: 180 individuals aged 7–9 years; Group 4: 100 individuals aged 10–12 years; Group 5: 7 individuals aged 13–15 years and Group 6: 111 individuals aged 16–18 years. In these groups, the percentage of S. aureus carriers found were 9.75%; 56.64%; 71.11% (p < 0.05 with respect to carriers 1–3, years); 82% (p < 0.01 with respect to carriers 1–3, years); 42.85% and 59.45%, respectively (Figure 1).

Figure 1.

Percentage of S. aureus carriers and MSSA and MRSA strains isolated by age group.

3.2 Antibiotic resistance and identification of MSSA and MRSA strains of S. aureus

The antibiotic to which the isolated S. aureus strains show the greatest resistance is penicillin (87% overall resistance, 89% in nasal strains and 84% in pharyngeal strains), followed by erythromycin (34% overall resistance, 32% in pharyngeal strains and 31% in nasal strains), and in third place clindamycin and tetracycline (with an overall resistance of 14%, 17% in the nose and 13% in the pharynx). Other antibiotics such as cephalothin, macrolides, ciprofloxacin, trimethoprim-sulfamethoxazole and fosfomycin showed similar resistance percentages (between 8 and 12% resistance). In the case of gentamicin and oxacillin, less than 8% of the isolated strains showed resistance and no strain was resistant to vancomycin (Figure 2).

Figure 2.

Percentage of S. aureus strains resistant to antibiotics. CIP: ciprofloxacin, FO: fosfomycin. TSX: trimethoprim-sulfamethoxazole, P: penicillin, VA: vancomycin, TE: tetracycline, E: erythromycin, OX: oxacillin, MAC: macrolides, CC: clindamycin, GM: gentamicin, and CF: cephalothin.

Regarding methicillin resistance, it was found that 482 (92.16%) strains were MSSA (p < 0.0001), of which 209 (39.96%) were found in nose and 273 (52.20%) in pharynx (Figure 3). Regarding gender, 278 strains were isolated from males (57.67%) and 204 were isolated from females (42.33%) (p > 0.05). When analyzed by age group, 6 MSSA strains were found in 1–3-year-olds (1.14%), 82 in the 4–6-year-old group (15.67%), 211 in the 7–9-year-olds (40.34%, p < 0.01), 92 in the 10–12 year old group (17.59%), 5 strains in the 13–15-year-old group (0.95%) and 86 MSSA strains in the 16–18-year-old group (16.44%) (Figure 1).

Figure 3.

MSSA and MRSA strains isolated from pharynx and nose.

It was found that 7.04% of the studied population were carriers of MRSA strains. Forty-one MRSA strains were isolated representing 7.84% of the total number of S. aureus strains, of which 11 were isolated from the pharynx (2.10%) and 30 from the nose (5.74%) (Figure 3). When analyzed by gender, 26 MRSA strains were isolated from males (63.41%) and 15 were isolated in females (36.59%). Besides, the age group 7–9 years was where more MRSA strains were found with 23 strains (4.39%, p < 0.05), followed by the age group 4–6 years with 8 (1.52%), 16–18 years with 5 strains (0.95%), 10–12 years with 4 strains (0.76%), while in children 1–3 only one MRSA strain was found (0.19%) and in the group 13–15, there was no isolation of MRSA strains (Figure 1).

Figure 4 shows the comparison of antibiotic resistance between MSSA and MRSA strains, the only antibiotic showing a significant difference was oxacillin (p < 0.0001). Similar to that shown in Figure 2, penicillin is the antibiotic to which both types of strains show the most resistance (93.17% and 84.21% between MRSA and MSSA strains respectively), followed by erythromycin (29.45% MRSA, 21.45% MSSA), clindamycin, ciprofloxacin, cephalothin, tetracycline, trimethoprim-sulfamethoxazole, macrolides (approximately 9% MRSA and 8% MSSA) and gentamicin (5.42% MRSA and 2.93% MSSA), no vancomycin-resistant strains were found.

Figure 4.

Antibiotic resistance of MRSA and MSSA strains. CIP: ciprofloxacin, FO: fosfomycin. TSX: trimethoprim-sulfamethoxazole, P: penicillin, VA: vancomycin, TE: tetracycline, E: erythromycin, OX: oxacillin, MAC: macrolides, CC: clindamycin, GM: gentamicin, and CF: cephalothin. **** p < 0.0001.

3.3 MRSA strain typing

Table 3 shows the typing data of the 41 MRSA strains. It was found that 6 strains presented staphylococcal cassette chromosome (SCCmec) II (14.63%), 4 nasal (13.33%) and 2 pharyngeal (18.18%), so these would be HA-MRSA strains (14.64%). While 35 community-acquired MRSA strains were found (85.36%), of which 20 strains were typed as SCCmec IV (48.78%), 15 were isolated from the nose (50%) and 5 from the pharynx (45.45%). The SCCmec IVa variant was found in 14 strains (34.14%), 10 nasal (33.33%) and 4 pharyngeal (36.36%), while SCCmec V was only found in one nasal strain.

StrainSiteGenderAgemecAluk-PVpsmSCCmecMRSA-typespa-type
105 NNF4+−−IVCA-MRSAt-527
106FPM5++−IVCA-MRSAt-527
120 NNM5+−−IVaCA-MRSAt-6367
133FPM6++−IVCA-MRSAt-084
511 NNF18+−−IVCA-MRSAt-8163
611 NNM6+++IVCA-MRSAt-909
612 NNM6+−−IVCA-MRSAt-2651
617FPM7+−−IVCA-MRSAt-14362
628 NNM8+−−IVaCA-MRSAt-3380
635 NNM7+−+IVaCA-MRSAt-16665
637 NNM8+−−IIHA-MRSAt-1406
638 NNM8+−−IVCA-MRSAt-723
639 NNM7+−−IVaCA-MRSAt-136
642 NNF7+++IVCA-MRSAt-723
644 NNF7+−−IVCA-MRSAt-4976
645 NNM8+−+IVaCA-MRSAt-645
647 NNF7+−−IVaCA-MRSAt-922
657 NNF8+−−IVCA-MRSAt-253
659 NNM8+−−IVCA-MRSAt-4318
663FPF8+−−IIHA-MRSAt-909
667FPF8+−−IVCA-MRSAt-253
677 NNF9+−−IVaCA-MRSAt-1710
680 NNM9+−−IVCA-MRSAt-701
687 NNM10+−+IVCA-MRSAt-304
689 NNM8+−−IVCA-MRSAt-701
690 NNF9+−−IVCA-MRSAt-4976
691 NNM9+−−IIHA-MRSAt-701
752 NNM12++−IVaCA-MRSAt-4468
754FPM12+++IVaCA-MRSAt-136
845 NNF7+++IVCA-MRSAt-189
980FPF18+−−IIHA-MRSAt-021
1236 NNM6+−+IIHA-MRSAt-346
1237 NNM6++−IIHA-MRSAt-021
1251FPM7++−IVCA-MRSAt-5747
1293 NNM17++−VCA-MRSAt-209
1521FPF18+−−IVaCA-MRSAt-02
1547FPF17+−−IVaCA-MRSAt-3955
1631 NNM10+−−IVaCA-MRSAt-012
1632 NNM7+−−IVaCA-MRSAt-012
1638FPM7+−−IVaCA-MRSAt-189
1705 NNF2+−+IVCA-MRSAt-189

Table 3.

Genotyping of MRSA strains isolated from pharynx and nose in children and adolescents.

P: pharynx, N: nose, F: female, M: male, +: positive, −: negative, CA-MRSA: community methicillin-resistant S. aureus strain, HA-MRSA: hospital methicillin-resistant S. aureus strain.

All strains presented the mecA gene; in the case of the PVL gene, 10 strains presented it (24.39%), 4 pharyngeal strains and 6 nasal strains. For the phenol soluble modulin gene (psm) 9 strains were positive (21.95%), of which 8 corresponded to nasal strains and 1 to a pharyngeal strain (Table 3).

A great diversity of spa-types was found, the most repeated spa-type was t-189 in three strains, twice spa-types were found: t-012, t-136, t-253, t-527, t-701, t-723, t-909, t-1210 and t-4976, the other spa-types were only found in one strain each (Table 3).

Advertisement

4. Discussion

The importance of studying S. aureus carriers lies in the fact that these individuals are more likely to have a subsequent infection [3], and many apparently healthy children develop life-threatening infections as asymptomatic carriers of S. aureus [21]. Permanent colonization of MRSA strains can lead to an increase in infections by up to 25% [22]. This makes surveillance of children carrying or colonized by S. aureus an important prevention mechanism.

In this study, 62.55% of S. aureus carriers were found in the pediatric population studied; this value is higher than that found in other studies that found up to 40% of carriers [3]. We found that pharyngeal exclusive carriers were 21.47%, nasal exclusive carriers 13.74% and 27.31% in both sites carriers, highlighting that they are apparently healthy S. aureus carriers from daycare centers and schools, in this sense, Esposito et al.; in 2014 [23] investigated healthy school children and adolescents in Milan, Italy, reporting a 53% colonization by S. aureus, specifically 26% of pharyngeal carriers, 39% nasal and 12% in both sites, with results similar to those found in this work. However, colonization depends on the ecological niche; we found more pharyngeal than nasal carriers as reported in other studies [23, 24, 25, 26, 27, 28, 29].

Age plays an important role; it has been seen that children 12 months of age have a higher incidence of S. aureus bacteremia than older children. Low birth weight and earlier gestational age are considered risk factors for colonization and worse outcomes of S. aureus episodes [30].

In this sense, we found that colonization increases with age, with significance in the age groups 7–9 (p < 0.05) and 10–12 years (p < 0.01) with respect to the group of 1–3 years. This is in agreement with what was found in Spain where colonization increases above 5 years of age [3]. With respect to gender, significant differences were only found in nasal colonization, with women being more colonized than men (p < 0.01). There are reports of higher colonization in men, as well as living in urban areas, attending schools or daycare centers and presenting previous skin infections as well as chronic diseases (asthma, atopic dermatitis, allergies) [3].

Determining the type of methicillin resistance of S. aureus strains is important because MRSA and MSSA strains have different characteristics and pathogenicity [1, 5], this is also reflected in the clinic, as infections caused by MSSA strains are higher than those caused by MRSA strains [4], 72% of bacteremias and meningitis in infants are caused by MSSA strains [4]. In addition, MRSA and MSSA strains are the main responsible for skin and soft tissue infections in school-age children (6 to 11 years old in particular), being important that the same strain can cause repeated infections in up to 90% of the cases [31]. However, within the current epidemiology, MRSA has shown a downward trend with a decrease since the 2000s [4, 32], However, the opposite has been observed in MSSA strains, with an increase in their prevalence, which generates an increase in infections at hospital and community level. Therefore, MSSA infection has gained ground as there has been an increase in infections, which generates concern for a greater distribution of this strain at hospital and community level [4].

Regarding the type of S. aureus strains, we found a higher percentage of MSSA strains (92.16%) compared to MRSA strains (7.84%), these percentages are in agreement with the findings by Ericson et al. [4], which show that 72.1% of the infections are caused by MSSA against 27.9% produced by MRSA strains. However, our data are for colonization and not for infection, so the difference in the percentages may be because our study population is not hospitalized but community-based and apparently healthy.

MSSA strains were found in a higher percentage in the pharynx than the nose, unlike MRSA strains, which were found more in the nose than in the pharynx (Figure 3). In this regard, a study conducted in the USA found that S. aureus colonizes the nose between 28 and 32% [32], we only found 13.74% of carriers exclusively in the nose, but if we take into account carriers from both sites, the percentage is 35.21%, which is similar to the study by Macnow et al. [30]. However, the percentage of nasal MRSA strains in that study ranged from 0.9% to 1.5%; we found a higher percentage of 5.74% nasal and 2.1% pharyngeal. This increase could be due to the difference in the country and the time of the study carried out, since there is a difference of more than ten years with respect to ours, and colonization by MRSA strains has been increasing as mentioned in other studies [5, 32, 33].

With respect to Mexico, studies regarding the colonization of S. aureus in the pediatric population are limited; it has been reported that in 2001 the prevalence of MRSA strains was 17 to 23%, but decreased to 4% in 2002, possibly due to control measures in hospitals [22]. In our study, we found a colonization of 7.04% of MRSA strain carriers in the community population studied, also different from the 1.44% reported in Spain [3], these differences are possibly due to the fact that these studies were carried out in hospitals, unlike ours, which is an apparently healthy community population.

In several studies carried out in various hospitals in Mexico, the presence of MRSA strains has been reported, mainly HA-MRSA strains, but the presence of CA-MRSA strains has also been reported, so that both types are circulating in hospitals [22]. In our study, we found more CA-MRSA strains (85.36%) than HA-MRSA (14.64%) which is expected since the population studied was not in hospitals. This also coincides with the fact that CA-MRSA strains have increased in the population [21, 32]. The infection rate in children by CA-MRSA strains varies according to the country. In Argentina, 65% of bacteremias in children are caused by CA-MRSA, in the USA 31.6% of infections by this strain were reported, while in Greece the CA-MRSA strain was identified in 35% of children with osteoarticular infection and 75% with pneumonia [3]. In our case, only 6% of people colonized with CA-MRSA strains were found, which is a low percentage compared to previous data, but it should be considered that the population studied is from the community and not hospitalized people.

Although the percentage of MRSA strains was low, this does not mean that the population studied is not at risk, since the percentage of MSSA strains was high and it has been shown that infant mortality after infection with MRSA or MSSA strains is similar [4]. However, MSSA strains cause more infections and deaths in infants than MRSA strains [4], therefore, infection prevention should include MSSA strains in addition to MRSA strains.

Another aspect to be reviewed is the antibiotic treatment of S. aureus infections in the pediatric population, which is a major challenge at present, so it is necessary to take into account the epidemiology, the type of exposure, the characteristics of the strain and the patient in order to provide adequate treatment [4, 11]. In this regard, MRSA and MSSA strains are susceptible to various antibiotics, and in this study, as in others, resistance to penicillin is very high [34, 35], In this study, we found around 90% of strains resistant to penicillin, erythromycin was the second most resistant antibiotic, the other antibiotics analyzed showed less than 20% resistance. In this regard, there are reports that MRSA strains are more resistant to antibiotics than MSSA strains [36, 37, 38], in our case was no exception and we found a difference of about 10% more MRSA strains than MSSA-resistant to penicillin and erythromycin, similar to other reports [3, 39, 40]. It should be noted that no vancomycin-resistant strains were found. When there is suspicion of infection by MRSA strains, the basis of treatment is usually vancomycin (vancomycin plus nafcillin or oxacillin), cephalosporins, clindamycin, linezolid or ceftaroline [9, 12]. Unfortunately, the literature mentions that there are pediatric populations that do not tolerate treatment with vancomycin, so alternatives such as daptomycin, ceftaroline and even linezolid should be chosen [9]. Another important aspect to consider is the timing of treatment. Currently, an adequate duration of antibiotic therapy in the pediatric population has not been established, so it is important to address this issue. There are proposals for temporality, which advise a duration of intravenous antibiotic therapy of 7–14 days and even up to 6 weeks in endocarditis [9]. Finally, antibiotic treatment depends on the type of S. aureus strain causing the infection and the characteristics of the host to avoid therapeutic failures and increased morbidity and mortality.

The infection generated by this bacterium is mediated by genetic factors, which determine its pathogenicity and virulence. All the MRSA strains isolated presented the mecA gene, 24.39% presented the PVL gene and 21.95% the psm gene, finding strains that presented both genes, which are CA-MRSA strains, it has been seen that these proteins are important for the pathology of the bacterium [41, 42, 43, 44], strains carrying these genes are more virulent and should be under surveillance [43, 45, 46]. Finding these strains in the pediatric community is a call to be alert to their dissemination and to perform control measures.

The diversity of serotypes found in MRSA strains is very large, which speaks of the great variety of strains present in the community and the wide genetic variability of this bacterium, which has been previously reported [25, 47].

The host is another important factor in S. aureus infection and it has been seen that in children this bacterium can be found more commonly in sites other than the nose, such as the pharynx, inguinal folds, axillae, umbilicus and umbilicus [32, 48]. As was found in this study, there are more carriers in the pharynx than in the nose. Therefore, in high-risk populations, surveillance programs (nasal and pharyngeal screening) should be carried out to detect colonization by S. aureus. This has already been proven in decolonization protocols in orthopedic and cardiac surgery patients [4, 49]. Therefore, surveillance and decolonization programs in the pediatric population may help to decrease the rates of colonization, infection and death caused by S. aureus.

Advertisement

5. Conclusion

In this study, a high percentage of S. aureus carriers was found in the pediatric population studied. A greater number of S. aureus strains were isolated from the pharynx than from the nose. A higher presence of nasal S. aureus was found in women than in men (p < 0.01). Penicillin is the main antibiotic to which pharyngeal and nasal strains are resistant (>80%), followed by erythromycin (>30%), clindamycin and tetracycline (>15%). No strains resistant to vancomycin were found. The number of MSSA strains is higher than MRSA strains, a greater number of CA-MRSA than HA-MRSA strains were found, some with virulence factors such as PVL and psm. The spa types found were very diverse. Therefore, it is important to establish detection and decolonization programs in the pediatric population of the community to avoid possible infections and deaths caused by this bacterium.

Advertisement

Conflict of interest

The authors declare no conflict of interest.

References

  1. 1. Mlynarczyk-Bonikowska B, Kowalewski C, Krolak-Ulinska A, Marusza W. Molecular mechanisms of drug resistance in Staphylococcus aureus. International Journal of Molecular Sciences. 2022;23(15):8088
  2. 2. Keim KC, Horswill AR. Staphylococcus aureus. Trends in Microbiology. 2023;31(12):1300-1301
  3. 3. Del Rosal T, Méndez-Echevarría A, Garcia-Vera C, Escosa-Garcia L, Agud M, Chaves F, et al. Staphylococcus aureus nasal colonization in Spanish children. THE COSACO nationwide surveillance study. Infection and Drug Resistance. 2020;13:4643-4651
  4. 4. Ericson JE, Popoola VO, Smith PB, Benjamin DK, Fowler VG, Benjamin DK, et al. Burden of invasive Staphylococcus aureus infections in hospitalized infants. JAMA Pediatrics. 2015;169(12):1105-1111
  5. 5. Lee AS, de Lencastre H, Garau J, Kluytmans J, Malhotra-Kumar S, Peschel A, et al. Methicillin-resistant Staphylococcus aureus. Nature Reviews Disease Primers. 2018;4:18033
  6. 6. Bustos-Martínez JA, Hamdan-Partida A, Gutiérrez-Cárdenas M. Staphylococcus aureus: The re-emergence of a pathogen in the community. Rev Bioméd. 2006;17(4):287-305
  7. 7. Kalu IC, Kao CM, Fritz SA. Management and prevention of Staphylococcus aureus infections in children. Infectious Disease Clinics of North America. 2022;36(1):73-100
  8. 8. González-García S, Hamdan-Partida A, Bustos-Hamdan A, Bustos-Martínez J. Factors of nasopharynx that favor the colonization and persistence of Staphylococcus aureus. In: Zhou X, Zhang Z, editors. Pharynx – Diagnosis and Treatment. London, UK, United Kingdom: IntechOpen; 2021. pp. 75-81
  9. 9. McMullan BJ, Campbell AJ, Blyth CC, McNeil JC, Montgomery CP, Tong SYC, et al. Clinical management of Staphylococcus aureus bacteremia in neonates, children, and adolescents. Pediatrics. 2020;146(3):e20200134
  10. 10. Campbell AJ, Al Yazidi LS, Phuong LK, Leung C, Best EJ, Webb RH, et al. Pediatric Staphylococcus aureus bacteremia: Clinical Spectrum and predictors of poor outcome. Clinical Infectious Diseases. 2022;74(4):604-613
  11. 11. Newnam KM. Surveillance and isolation of methicillin-resistant Staphylococcus aureus colonization in the neonatal intensive care unit. Advances in Neonatal Care. 2016;16(4):298-307
  12. 12. Oestergaard LB, Schmiegelow MDS, Bruun NE, Skov R, Andersen PS, Larsen AR, et al. Staphylococcus aureus bacteremia in children aged 5-18 years-risk factors in the new millennium. The Journal of Pediatrics. 2018;203:108-115.e3
  13. 13. James G. Universal bacterial identification by PCR and DNA sequencing of 16S rRNA gene. In: Schuller M, Sloots T, James G, Halliday C, Carter I, editors. PCR for Clinical Microbiology. Dordrecht: Springer; 2010:209-214
  14. 14. CLSI. Performance Standards for Antimicrobial Disk Suceptibility Test. 13th ed. Pennsylvania, Wayne: Clinical and Laboratory Standards Institute; 2018
  15. 15. Oliveira DC, de Lencastre H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 2002;46(7):2155-2161
  16. 16. Boye K, Bartels MD, Andersen IS, Møller JA, Westh H. A new multiplex PCR for easy screening of methicillin-resistant Staphylococcus aureus SCCmec types I–V. Clinical Microbiology and Infection. 2007;13(7):725-727
  17. 17. Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-valentine leukocidin—Producing Staphylococcus aureus in primary skin infections and pneumonia. Clinical Infectious Diseases. 1999;29(5):1128-1132
  18. 18. Mehlin C, Headley CM, Klebanoff SJ. An inflammatory polypeptide complex from Staphylococcus epidermidis: Isolation and characterization. The Journal of Experimental Medicine. 1999;189(6):907-918
  19. 19. Shopsin B, Gomez M, Montgomery SO, Smith DH, Waddington M, Dodge DE, et al. Evaluation of protein a gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. Journal of Clinical Microbiology. 1999;37(11):3556-3563
  20. 20. Asghar AH. Molecular characterization of methicillin-resistant Staphylococcus aureus isolated from tertiary care hospitals. Pakistan Journal of Medical Sciences. 2014;30(4):698
  21. 21. Immergluck LC, Leong T, Malhotra K, Parker TC, Ali F, Jerris RC, et al. Geographic surveillance of community associated MRSA infections in children using electronic health record data. BMC Infectious Diseases. 2019;19(1):170
  22. 22. Ortíz-Gil MÁ, Cardona-Alvarado MI. The molecular epidemiological study of MRSA in Mexico. In: Bustos-Martínez J, Valdez-Alarcón JJ, editors. Staphylococcal Infections – Recent Advances and Perspectives. London, UK, United Kingdom: IntechOpen; 2023
  23. 23. Esposito S, Terranova L, Zampiero A, Ierardi V, Rios WP, Pelucchi C, et al. Oropharyngeal and nasal Staphylococcus aureus carriage by healthy children. BMC Infectious Diseases. 2014;14:723
  24. 24. Hamdan-Partida A, Sainz-Espuñes T, Bustos-Martínez J. Characterization and persistence of Staphylococcus aureus strains isolated from the anterior nares and throats of healthy carriers in a Mexican community. Journal of Clinical Microbiology. 2010;48(5):1701-1705
  25. 25. Hamdan-Partida A, González-García S, de la Rosa GE, Bustos-Martínez J. Community-acquired methicillin-resistant Staphylococcus aureus can persist in the throat. International Journal of Medical Microbiology. 2018;308(4):469-475
  26. 26. Nilsson P, Ripa T. Staphylococcus aureus throat colonization is more frequent than colonization in the anterior nares. Journal of Clinical Microbiology. 2006;44(9):3334-3339
  27. 27. Mertz D, Frei R, Jaussi B, Tietz A, Stebler C, Flückiger U, et al. Throat swabs are necessary to reliably detect carriers of Staphylococcus aureus. Clinical Infectious Diseases. 2007;45(4):475-477
  28. 28. Williamson DA, Ritchie S, Keren B, Harrington M, Thomas MG, Upton A, et al. Persistence, discordance and diversity of Staphylococcus aureus nasal and oropharyngeal colonization in school-aged children. The Pediatric Infectious Disease Journal. 2016;35(7):744-748
  29. 29. González-García S, Hamdan-Partida A, Valdez-Alarcón JJ, Bustos-Hamdan A, Bustos-Martínez J. Main factors of Staphylococcus aureus associated with the interaction to the cells for their colonization and persistence. In: Bustos-Martínez J, Valdez-Alarcón JJ, editors. Staphylococcal Infections – Recent Advances and Perspectives. London, UK, United Kingdom: IntechOpen; 2023
  30. 30. Mayorga Chavez D, Arnao Noboa A, Pereira OH. Risk factors associated with hospital stay in children with Staphylococcus aureus bacteremia. Revista Ecuatoriana de Pediatría. 2020;21(2):1-9
  31. 31. Cane F, Posfay-Barbe KM, Pittet LF. Hygiene measures and decolonization of Staphylococcus aureus made simple for the pediatric practitioner. The Pediatric Infectious Disease Journal. 2024;43(5):e178-e182
  32. 32. Macnow T, O’Toole D, DeLaMora P, Murray M, Rivera K, Whittier S, et al. Utility of surveillance cultures for antimicrobial resistant organisms in infants transferred to the neonatal intensive care unit. The Pediatric Infectious Disease Journal. 2013;32(12):e443-e450
  33. 33. Rojo P, Barrios M, Palacios A, Gomez C, Chaves F. Community-associated Staphylococcus aureus infections in children. Expert Review of Anti-Infective Therapy. 2010;8(5):541-554
  34. 34. Rao S, Linke L, Magnuson R, Jauch L, Hyatt DR. Antimicrobial resistance and genetic diversity of Staphylococcus aureus collected from livestock, poultry and humans. One Health. 2022;11(15):100407
  35. 35. Vestergaard M, Frees D, Ingmer H. Antibiotic resistance and the MRSA problem. Microbiol Spectrum. 2019;7(2):10-1128. DOI: 10.1128/microbiolspec.gpp3-0057-2018
  36. 36. Thompson T, Brown PD. Comparison of antibiotic resistance, virulence gene profiles, and pathogenicity of methicillin-resistant and methicillin-susceptible Staphylococcus aureus using a Caenorhabditis elegans infection model. Pathogens and Global Health. 2014;108(6):283
  37. 37. Camacho-Cruz J, Gutiérrez IF, Brand-López K, Sosa-Rodríguez YA, Vásquez-Hoyos P, Gómez-Cortés LC, et al. Differences between methicillin-susceptible versus methicillin-resistant Staphylococcus aureus infections in pediatrics: Multicenter cohort study conducted in Bogotá, Colombia, 2014-2018. The Pediatric Infectious Disease Journal. 2022;41(1):12
  38. 38. Rahimi F, Bouzari M, Katouli M, Pourshafie MR. Antibiotic resistance pattern of methicillin resistant and methicillin sensitive Staphylococcus aureus isolates in Tehran, Iran. Jundishapur Journal of Microbiology. 2013;6(2):144-149
  39. 39. Karabiber N, Dinc BM. Erythromycin-heteroresistant methicillin-resistant Staphylococcus aureus isolates from Turkey. Clinical Microbiology and Infection. 2008;14(6):626-627
  40. 40. Zheng XY, Choy BNK, Zhou MM, Zhao ZY. Antibiotic resistance pattern of Staphylococcus aureus isolated from pediatrics with ocular infections: A 6-year hospital-based study in China. Frontiers in Pediatrics. 2021;9:728634
  41. 41. Qu MD, Kausar H, Smith S, Lazar PG, Kroll-Desrosiers AR, Iii CH, et al. Epidemiological and clinical features of Panton-valentine Leukocidin positive Staphylococcus aureus bacteremia: A case-control study. PLoS One. 2022;17(3):e0265476
  42. 42. Vittorakis E, Vică ML, Zervaki CO, Vittorakis E, Maraki S, Mavromanolaki VE, et al. Examining the prevalence and antibiotic susceptibility of S. Aureus strains in hospitals: An analysis of the pvl gene and its Co-occurrence with other virulence factors. Microorganisms. 2023;11(4):841
  43. 43. Bennett MR, Thomsen IP. Epidemiological and clinical evidence for the role of toxins in S. Aureus human disease. Toxins. 2020;12(6):408
  44. 44. Lade H, Chung SH, Lee Y, Joo HS, Kim JS. Genotypes of Staphylococcus aureus clinical isolates are associated with phenol-soluble Modulin (PSM) production. Toxins. 2022;14(8):556
  45. 45. Wu S, Zhang F, Huang J, Wu Q, Zhang J, Dai J, et al. Phenotypic and genotypic characterization of PVL-positive Staphylococcus aureus isolated from retail foods in China. International Journal of Food Microbiology. 2019;304:119-126
  46. 46. Klein S, Hannesen J, Zanger P, Heeg K, Boutin S, Nurjadi D. Entry of Panton–valentine leukocidin-positive methicillin-resistant Staphylococcus aureus into the hospital: Prevalence and population structure in Heidelberg, Germany 2015-2018. Scientific Reports. 2020;10(1):13243
  47. 47. Hamdan-Partida A, González-García S, Martínez-Ruíz FJ, Zavala-Sánchez MÁ, Bustos-Hamdan A, Bustos-Martínez J. Molecular characterization of Staphylococcus aureus strains isolated from mobile phones. Microorganisms. 2022;10(3):669
  48. 48. Whittington KJ, Malone SM, Hogan PG, Ahmed F, Flowers J, Milburn G, et al. Staphylococcus aureus bacteremia in pediatric patients: Uncovering a rural health challenge. Open Forum Infectious Diseases. 2023;10(7):ofad296
  49. 49. Chen AF, Wessel CB, Rao N. Staphylococcus aureus screening and decolonization in orthopaedic surgery and reduction of surgical site infections. Clinical Orthopaedics. 2013;471(7):2383-2399

Written By

Anaid Bustos-Hamdan, Samuel González García, Juan Antonio Guzmán Salgado, Aída Hamdan-Partida and Jaime Bustos-Martínez

Submitted: 06 August 2024 Reviewed: 29 October 2024 Published: 23 December 2024

© The Author(s). Licensee IntechOpen. This content is distributed under the terms of the Creative Commons 4.0 International License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Your cart

Discounts available on purchase of multiple copies. View rates

Subtotal £0.00

Local taxes (VAT) are calculated in later steps, if applicable.

Support: orders@intechopen.com